Mydogdiva2 Mydogdiva2

04-11-2015
Mathematics

contestada

One number is 12 more than half another number. The two numbers total 60. Find the numbers.

Respuesta :

Hipeople4944 Hipeople4944

04-11-2015

The answer would be 36 and 24. I'm sorry I can't give you an explanation like I normally do for people. I was just fiddling with my calculator to find the answer for you. Sorry.

Answer Link

Otras preguntas

Business contracts or marriage licenses are found in which stage of relational development

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

According to the Ajzen model, the strongest predictor of an employee’s behavior is (are):

The law of segregation states that allele pairs separate during gamete formation. How then do we have two alleles for a trait? We receive one allele from each

Monocytes are a type of white blood cell that can differentiate into what two cells?

PLEASE HELP!! What was the 90-day wage and price freeze? A) a temporary freeze on wages, prices, and rents B) a sale to help the economy C) a

Franklin delano roosevelt (january 30, 1882 to april 12, 1945) was the 32nd american president who led the united states through the great depression and world

How do you determine the type of ion charge any element will form based on its number of valence electrons?

2. You must use headlights when driving ___________________. A. between sunset and sunrise B. in rain C. half hour after sunset and half hour before sunrise D.

Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s